Em formação

Diferença entre DNA de satélite clássico e microssatélites / minissatélites

Diferença entre DNA de satélite clássico e microssatélites / minissatélites



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Sou muito novo nesta comunidade e tenho uma pergunta básica sobre sequências repetitivas de DNA.

Qual é a diferença entre o DNA de satélite (clássico) e os microssatélites / minissatélites?

Todos os livros didáticos fornecem exemplos concretos de microssatélites e / ou minissatélites como - (AC) 2 --- ou --- TACA (TAG) 3 - TACA ----.

O Classic Satellite DNA compartilha apenas as mesmas propriedades (perfeito, imperfeito, composto, complexo, di-nucleotídeos, tri-nucleotídeos, etc.) que os STRs ou Minisatélites, mas a única diferença é que o Classic Satellite DNA é mais longo?


Os Agentes Subvirais

CONTRIBUÍRAM POR , . R.B. Wickner, em Virus Taxonomy, 2005

LISTA DE MEMBROS

DNA de satélite de vírus de ageratum enation β

DNA do satélite β do vírus da veia amarela Ageratum

DNA do satélite β do vírus do mosaico da veia amarela de Bhendi

DNA do satélite do vírus da onda da folha de pimenta malagueta β

DNA do satélite β do vírus Alabad do enrolamento da folha do algodão

DNA do satélite β do vírus Gezira do cacho da folha do algodão

DNA do satélite β do vírus Kokhran da folha do algodão

DNA do satélite β do vírus Multan do enrolamento da folha do algodão

Enrolamento da folha de algodão satélite do vírus Rajasthan β

DNA do satélite do vírus da veia amarela Eupatorium β

DNA DNA do satélite β do vírus da amarração da folha do Hollyhock

DNA do satélite do vírus da veia amarela da madressilva β

DNA do satélite β do vírus da veia amarela do Malvastrum

DNA do satélite β do vírus da ondulação da folha do mamão

DNA do satélite de vírus de broto encaracolado do tabaco β

DNA do satélite do vírus da ondulação da folha do tomate β

Tomate yellow leaf curl DNA de satélite de vírus da China β


Diferença entre DNA de satélite clássico e microssatélites / minissatélites - Biologia

Processo de mutação: Microssatélites são marcadores genéticos úteis porque tendem a ser altamente polimórficos. Não é incomum ter microssatélites humanos com 20 ou mais alelos e heterozigosidades (Hexp = diversidade genética, D) de> 0,85. Por que eles são tão variáveis? A razão parece ser que suas mutações ocorrem de uma forma muito diferente daquela das mutações pontuais "clássicas" (onde ocorre a substituição de um nucleotídeo por outro, como um G substituindo um C). O processo de mutação em microssatélites ocorre por meio do que é conhecido como replicação de deslizamento. Se imaginarmos as unidades de repetição (por exemplo, uma repetição de dinucleotídeo AC) como contas em uma cadeia, podemos imaginar que durante a replicação duas fitas podem deslizar um pouco as posições relativas, mas ainda conseguem fazer o zíper descer pelas contas. Uma fita ou outra pode então ser alongada ou encurtada por adição ou excisão de nucleotídeos. O resultado será uma nova "mutação" que compreende uma unidade de repetição que é uma conta mais longa ou mais curta do que a original. A ideia de que adicionar ou subtrair uma repetição é provavelmente mais fácil do que adicionar ou subtrair duas ou mais contas é a base para usar o Modelo de Mutação Stepwise (SMM) em oposição ao Modelo de alelos infinitos (EU SOU). Uma vantagem do SMM (pelo menos em teoria) é que a diferença de tamanho então transmite informações adicionais sobre a filogenia dos alelos. No IAM, os dois únicos estados são "iguais" e "diferentes". Sob o SMM, temos um continuum potencial de diferentes semelhanças (mesmo tamanho, semelhante em tamanho, muito diferente em tamanho). Se, no entanto, o SMM não se mantiver, poderemos ser pior usá-lo - pode, na verdade, ser altamente enganoso. Mesmo que o processo de mutação subjacente seja amplamente gradativo, não é difícil ver como a deriva pode afetar a distribuição dos tamanhos dos alelos de uma forma que invalidaria quase totalmente o SMM (visualize isso examinando as Figs. 6.1 e 6.2 na Aula 6).

    Locus-specific (em contraste com marcadores multilocais, como minissatélites ou RAPDs)
    Codominante (heterozigotos podem ser distinguidos de homozigotos, em contraste com RAPDs e AFLPs que são & quot binários, 0/1 & quot)
    Baseado em PCR (significa que precisamos apenas de pequenas quantidades de tecido trabalhando em DNA altamente degradado ou "antigo")
    Altamente polimórfico ("hipervariável") - fornece um padrão considerável
    Útil em um gama de escalas de ID individual a filogenias em escala fina

1) Extrair DNA de tecido (ampla variedade de métodos possíveis, dependendo do tipo de tecido)

2) Fragmento o genoma. Corte nosso DNA genômico em fragmentos de tamanho adequado com Enzimas de restrição. Geralmente, as enzimas de restrição que produzem tamanhos médios de fragmentos na faixa de 300-600 bp são o objetivo desejado.

3) Inserir. Insira os fragmentos em plasmídeos. Esta etapa permite a clonagem dos fragmentos - produzindo muitas cópias das peças de 300-600 bp que inserimos nos plasmídeos. Para ter uma ideia um pouco mais detalhada de como os plasmídeos agem como vetores de clonagem, procure os termos em negrito no glossário da página de termos. PUC19 é um plasmídeo comumente usado para esse tipo de análise. Por que PUC19? o sites de restrição no PUC19 são conhecidos (para que os fragmentos de DNA ligados possam ser posteriormente cortados) e replica bem em uma cultura bacteriana.

4) Placa os plasmídeos em uma membrana de náilon.

5) Probe a membrana com oligonucleotídeos marcados de repetições desejáveis ​​(por exemplo, AC10).

6) Cultura os clones positivos (os fragmentos de plasmídeo que se ligaram às sondas oligo).

7) Cortar a inserção fora dos plasmídeos com enzimas de restrição e executá-los em um gel de agarose.

    a) para verificar a presença da repetição e
    b) para nos permitir estimar o tamanho da inserção.
    a) "compatibilidade" dos dois primers (eles não podem ser complementares porque isso causaria a ligação cruzada, eles precisam ter comprimentos e temperaturas de fusão muito semelhantes),
    b) evitar códigos de parada ou outras sequências que causariam falhas de PCR,
    c) evitar os locais de iniciação do primer que não se ligam bem, evitar os palíndromos (sequências que têm a mesma sequência em ambas as extremidades) e vários outros.
    d) comprimentos totais do produto amplificado de 100-250 bp, de forma que sejam viáveis ​​para os géis de sequenciamento ou genotipadores automatizados que usaremos para visualização.
    e) evitar repetições perto do final da região sequenciada. Alguns dos clones positivos que sequenciamos podem ter boas unidades de repetição, mas estar muito próximos do final da sequência. Falta então região flanqueadora suficiente para projetar um primer. Em parte, é por isso que queremos fragmentos de 300-600 bp - curtos o suficiente para serem viáveis ​​para sequenciamento, mas longos o suficiente para reduzir a probabilidade de que a repetição seja um "gancho".

11) Pedido os iniciadores específicos de locus (geralmente estes serão seções de 20-30 bp das regiões flanqueadoras não imediatamente adjacentes à unidade de repetição).

Aqui está um exemplo de uma sequência de microssatélites para scrub-jays que contém uma unidade de repetição e locais de primer direto e reverso.
SJR3 [FSJ]
GCCAAGCTTGCATGCCTGCAGGTCGACTCT AGAGGATCCCCAAGTGTATGT GCATACACGTG
CACACACACACACACACACACA GAGGGTGTGCACATGTGCATGCACACTCCAAGAGACAGTG
CCTAGTAAAGTGTCTC AGCACCATCTGCAGCAAACAG GTTCTGCAAAAACCAATCCCAACTGA
TGTTCCCACAGTGACACTGT

Do início do primer direto ao final do primer reverso, o acima é 131 bp. A repetição é CA11
o a unidade de repetição é destacada em vermelho , enquanto o frente e reverter p r i m e r s são destacados em azul e verde . Enviaríamos um pedido para as sequências de primer (no nosso caso, adicionamos 19 bp adicionais M13 cauda, ​​o que nos permite anexar nucleotídeos fluorescentes / dNTPs ao nosso produto amplificado no PCR). Um laser em nosso sequenciador / genotipador automatizado detecta a fluorescência, que é como nós visualizar as bandas que constituem os dados alélicos que esperamos reunir e analisar.

1) Extraia o DNA. Freqüentemente, começa-se quebrando de alguma forma o tecido (por exemplo, moendo nitrogênio líquido). Alternativas para o processo de extração incluem extrações clássicas de fenol-clorofórmio, extrações à base de sal e uma variedade de kits comerciais. Nesta etapa, estamos eliminando proteínas e outros componentes de tecido que não são de DNA. Uma análise típica pode incluir a extração de DNA de cada um dos indivíduos em uma população local de 30 indivíduos.

2) Amplificar. Adicionamos uma quantidade muito pequena de cada uma de nossas 30 amostras de DNA extraídas a um coquetel de PCR para amplificação em um termociclador. Este é um passo "mágico" que revolucionou a biologia molecular. Começamos quase sem DNA e acabamos com o suficiente para que possamos ver em um gel! Existem várias receitas de "coquetéis" - eles geralmente contêm a enzima bacteriana termofílica Taq polimerase (essencial), a mistura de dNTP (nucleotídeos que permitirão a replicação massiva de nosso DNA alvo), cloreto de magnésio e os dNTPs marcados com fluorescência (estes se ligam à cauda M13 ou T3 especialmente adicionada e iluminam-se sob o laser e fazem bandas de alelos de DNA aparecem no gel).

3) Carga. Carregamos nossos 30 produtos amplificados em pistas separadas em um grande gel de poliacrilamida vertical. Também carregamos várias pistas com um DNA escada - fragmentos de DNA amplificado de tamanho conhecido e quantidade / concentração conhecida. Uma escada comum é o fago lambda cortado com enzimas de restrição para produzir uma série de fragmentos. Os sequenciadores capilares mais novos não usam gel.

4) Execute o sequenciador. Corremos o produto amplificado pelo sequenciador até que todos os alelos tenham tempo de passar pelo laser, que ilumina os nucleotídeos fluorescentes e faz as bandas acenderem no gel (ou ir digitalmente direto para o computador). O sequenciador gera uma imagem analógica (para sequenciadores mais antigos baseados em gel) e dados armazenados digitalmente relativos ao tamanho dos fragmentos.

5) Otimize (variações nas etapas 2 a 4). Freqüentemente, é necessário um trabalho considerável para obter as condições de PCR corretas para uma combinação específica de primer, DNA, termociclador e sequenciador. As principais variáveis ​​na otimização incluem:
temperatura (a sequência do primer terá uma temperatura de fusão prevista, mas o que realmente funciona pode ser maior ou menor),
os tempos programados por PCR para as etapas de desnaturação, recozimento e extensão
concentrações de cloreto de magnésio

Métodos alternativos de visualização incluem géis de sequenciação de poliacrilamida "feitos à mão" com coloração com prata, coloração CyberGreen, coloração com brometo de etídio ou marcação radioativa. Muitos deles envolvem produtos químicos desagradáveis ​​(EtBr) ou radioatividade, por isso nos sentimos afortunados por usar um procedimento relativamente limpo e seguro.

Fig. 8.1. Diagrama estilizado de um gel eletroforético para microssatélites. Uma corrente atrai DNA amplificado para baixo
"pistas" no gel de poliacrilamida. Os fragmentos podem ser separados por tamanho (bp = pares de bases) e indivíduos
podem ser genotipados quanto à sua composição alélica (homozigoto ou heterozigoto para um ou mais alelos). Aqui
a pista da esquerda tem uma "escada" de fragmentos de tamanho conhecido, a segunda pista tem o DNA de um indivíduo
(genótipo ac) e a terceira faixa tem o DNA de um segundo indivíduo (genótipo de Anúncios) Executando vários loci
fornece uma riqueza de informações genéticas sobre indivíduos, populações ou espécies.

E. Como analisamos as informações alélicas? Para uma descrição um pouco mais detalhada, vá para a página Análise genética.
Você também pode baixar meu documento do Word no software Web Genetic. Luikart e England (1999) fornecem uma visão geral (mais antiga) das abordagens. Para o uso de marcadores alternativos, consulte os artigos (principalmente do TREE) de Sunnucks (2000), Mueller e Wolfenbarger (1999 AFLP), Campbell et al. (2003 AFLP) e Brumfield et al. (SNPs de 2003 - polimorfismos de nucleotídeo único).

    1) Ferramentas tradicionais de genética populacional
      Heterozigosidade (Hobs, Hexp = D)
      Equilíbrio de Hardy-Weinberg
      Desequilíbrio de ligação
      FST e outro F-Estatisticas
      Distâncias genéticas (acorde Cavalli-Sforza, distâncias de Nei s 1972 e 1978)
      Estimativas de 4Ne me 4Nem. (m para mutação, m para migração)

    2) Medidas específicas de microssatélites (principalmente contando com SMM, Modelos de mutação Stepwise)

    (delta mu ao quadrado) de Goldstein et al. 1995
    DSW de Shriver et al. (1995)
    RST de Slatkin (1995) conforme implementado por Goodman (1997)
    de Michalakis e Excoffier (1996)


    Microssatélites e tipagem VNTR em ambientes clínicos

    Para obter uma versão para impressão do teste de maio CE, vá AQUI ou para fazer o teste online, vá AQUI. Para obter mais informações, visite a guia Educação Continuada.

    Após a conclusão deste artigo, o leitor será capaz de:

    1. Lembre-se da biologia geral dos microssatélites e dos eventos que ocorrem que levam à diversidade aleatória de marcadores genéticos.

    2. Discuta a técnica envolvida na avaliação dos loci VNTR.

    3. Descreva as aplicações clínicas nas quais a tipagem VNTR é usada.

    4. Discuta os benefícios da digitação VNTR.

    Uma aplicação da tecnologia molecular é no que é coloquialmente conhecido como "impressão digital de DNA" ou "perfil de DNA". A analogia da impressão digital é adequada, pois o método gera um padrão biométrico reproduzível que é único para um indivíduo, mas fornece pouca ou nenhuma informação fenotípica sobre a fonte (gênero sendo a única exceção comum, conforme detalhado abaixo). O método também fornece dados que podem ser usados ​​para calcular a relação entre as amostras. Além de sua aparência comum em ambientes forenses criminais fictícios (e reais), a capacidade de vincular fragmentos de traços específicos de tecido humano a indivíduos e determinar objetivamente a relação entre as amostras é de uso real em estudos antropológicos e - mais para o nosso foco - em ambientes clínicos mundanos . O método mais comum para perfis de DNA é conhecido como Variável Nucleotídeo Tandem Repetição (VNTR) tipagem e será nosso foco atual.

    Terminologia

    Primeiro, alguma terminologia. Dentro dos cromossomos que compreendem o DNA nuclear da maioria dos organismos, incluindo humanos, muitas vezes existem regiões não codificantes intergênicas que consistem em várias repetições tandem (cabeça com cauda) de um único elemento curto (mais comumente 2, 3, 4 ou 5 bases). Os exemplos seriam (ATT) n ou (GTTAC) n, onde o conjunto parentético de nucleotídeos se repete em uma linha n vezes. Esses elementos são chamados de microssatélites. O nome deriva da idade das trevas da biologia molecular, quando o isolamento preparativo do DNA incluía ultracentrifugação de densidade flutuante em gradientes de CsCl. Devido à sua composição uniforme, fragmentos cortados de DNA de microssatélites formam bandas pequenas e distintas, ligeiramente separadas do material de DNA não repetitivo. Quando o número de repetições de elementos (n) excede cerca de 50, bandas únicas semelhantes, mas ligeiramente maiores, são formadas, e esses elementos mais longos de estrutura semelhante são chamados de minissatélites. Para manter as coisas desnecessariamente complicadas, os microssatélites também são chamados de Repetições Tandem Curtas (STRs) ou Repetições de Sequência Simples (SSRs), embora este último termo seja mais frequentemente aplicado na genética de plantas. Finalmente, ambos os microssatélites (por qualquer nome) e minissatélites são chamados coletivamente de VNTRs. Na prática, os termos tipagem STR, tipagem de microssatélites e tipagem VNTR são frequentemente usados ​​de forma intercambiável - uma terminologia imprecisa que às vezes pode levar à confusão onde as pessoas procuram por diferenças de significado que não foram pretendidas.

    Biologia

    Se houver o suficiente deles para ver como bandas distintas em gradientes de CsCl, não deve ser surpresa que haja muitos microssatélites no genoma humano. No geral, eles compreendem cerca de três por cento do genoma nuclear humano total, dispersos mais ou menos uniformemente em todos os cromossomos. Aqueles baseados em elementos de número ímpar (três ou cinco nucleotídeos) são cerca de metade tão comuns quanto aqueles com elementos de número par (dois, quatro ou seis nucleotídeos) e por motivo desconhecido - ou se houver um motivo - SSRs tripletos são mais comuns em associação com regiões de codificação. Não está claro se os microssatélites têm uma função biológica útil consistente, na maioria dos casos, parecendo não fazer nada ou então sendo patogênicos. Os exemplos patogênicos relacionados a repetições de trinucleotídeos têm seu próprio nome coletivo como distúrbios de repetição de trinucleotídeos. Um dos exemplos mais conhecidos é a doença de Huntington. Neste caso, o elemento de repetição CAG ocorre dentro de uma porção exônica (codificação de proteína) do gene HTT com cada repetição codificando para um resíduo de glutamina adicional em série na proteína Huntingtin madura. No n 40, a penetrância total (apresentação do pior caso) é observada e um risco de 50 por cento de transmissão da doença para a prole.

    Para nossa consideração atual, o que é de importância fundamental aqui é que os números de repetição (n) para um único locus microssatélites podem, às vezes, mudar entre as gerações. Um mecanismo pelo qual isso ocorre é conhecido como deslizamento da polimerase. Essencialmente, isso acontece durante a replicação do DNA se a atividade da polimerase pausar e a fita nascente se separar brevemente do molde antes de reanimar, pode recozer no registro em relação ao elemento de repetição a montante ou a jusante de onde ele se separou. À medida que a atividade da polimerase é retomada, a cadeia de progênie ganhou ou perdeu o número de cópias da repetição, respectivamente. Observa-se que o ganho de repetições ocorre com muito mais frequência do que a perda. Considerando esse mecanismo, é mais lógico que quanto mais longo é um microssatélite, maiores são as chances de ocorrer um evento de deslizamento durante a replicação. Em geral, há, portanto, uma tendência de ficar mais longo com o tempo e o grau de instabilidade aumenta à medida que eles ficam mais longos, criando um processo de feedback positivo. Em escalas de tempo evolucionárias, isso não se torna um processo descontrolado e deve ser restringido pela perda da adequação do organismo à medida que mais e mais regiões cromossômicas se tornam repetições curtas sem fim.

    Outro mecanismo que pode levar a mudanças no número de repetição de elementos mini e microssatélites é o cruzamento desigual. Os leitores são lembrados de que, durante a meiose, a quebra e a reintegração de pares de cromossomos homólogos permitem a recombinação de alelos. Essas quebras e junções ocorrem ao longo de elementos de sequência homóloga nos dois cromossomos, mas, como no caso do deslizamento da polimerase, é possível que ocorra uma mudança no registro por algum múltiplo do tamanho do elemento de repetição durante o alinhamento da fita. Os cromossomos recombinados resultantes terão um que ganhou repetições enquanto o outro perdeu um número igual. Em comum com o deslizamento da polimerase, esse tipo de instabilidade é cada vez mais provável de ocorrer à medida que o comprimento da região - ou seja, o número de repetições n - aumenta.

    É importante que haja mecanismos para mudança no número de cópias repetidas (isso cria marcadores diferenciáveis ​​ao longo do tempo) e que tais mudanças sejam individualmente bastante raras, ocorrendo em uma escala de tempo evolutiva (o que significa que podemos esperar em quase todos os casos, os tamanhos dos alelos permanecem fixos entre gerações). No geral, somos apresentados a um conjunto grande e disperso de VNTRs em todo o genoma, e devemos esperar que eles se comportem como um tamanho fixo ao passar de progenitor para progênie. Essa aleatoriedade de dispersão no genoma, diversidade populacional relativamente alta por locus e baixa frequência de variação adicional entre as gerações de organismos são a base de sua utilidade como marcadores genéticos.

    Técnica

    Na prática, os loci VNTR para avaliação são selecionados com base em sequências flanqueadoras altamente conservadas, um grande número de tamanhos de números repetidos vistos na população de interesse (em outras palavras, alta diversidade alélica) e bom comportamento de amplificação (amplificação confiável de loci verdadeiros em um ampla gama de concentrações de entrada, poucos ou nenhum produto de amplificação espúrio). Para facilidade de uso e conveniência no desempenho do ensaio, é ainda desejável multiplexar os loci em reações de amplificação simples, então loci com tamanhos de produto diferentes (isto é, produtos não sobrepostos) e cinética de amplificação semelhante e requisitos de reação comuns são selecionados para agrupar. Para cada locus VNTR individual, os iniciadores de PCR são selecionados que atendem a esses critérios, e um iniciador de PCR do par para cada locus é marcado por fluorescência. Como o método de detecção de extremidade suportará cinco canais de corante separáveis, um total de quatro corantes alvo estão disponíveis, o que significa que o requisito acima para amplicons de tamanho diferente não é absoluto, quando amplicons de dois loci podem ser de tamanho sobreposto, eles podem ser diferencialmente corante rotulado. Por uma combinação de tamanhos de produto esperados diferenciáveis ​​e uso de corantes diferentes onde os tamanhos podem se sobrepor, é possível multiplexar 15-20 loci diferentes em uma única reação. (Tecnicamente, os desafios de fazer tantas reações concorrentes amplificarem com eficiência quase igual podem tornar mais simples limitar as reações de PCR individuais a quatro a seis loci por conjunto multiplex e, em seguida, combinar produtos de várias dessas reações para a etapa de detecção).

    Considerando por um momento apenas um de nossos loci, se o amplificarmos por PCR em um organismo diplóide como um humano, esperamos produtos de dois alelos - um em cada par de cromossomos do hospedeiro. Para cada locus, esperamos obter nenhum amplicon (no caso de o locus ser deletado), ou um produto de um tamanho que é determinado pelo número de elementos repetidos presentes no microssatélite. Se tomarmos uma repetição triploide como exemplo e assumirmos algum espaço para sequências flanqueadoras onde nossos primers de PCR estão localizados, podemos encontrar uma amostra da população neste locus ver tamanhos de amplicon de 112 a 130 nucleotídeos de comprimento em intervalos de 3 nt. Cada um desses tamanhos discretos ocorrerá em alguma frequência na população. Se estendermos isso para a situação diplóide, esperamos ver nenhum amplicon (locus homozigoto excluído, ambos os alelos) um produto de tamanho (onde ambos os alelos são homozigotos para o mesmo número de repetição) ou dois produtos (onde os alelos são heterozigotos para repetir o número). Em qualquer caso, você não pode pontuar nenhum, um ou dois produtos e os produtos, se presentes, terão tamanhos conhecidos e predeterminados.

    Uma nuance comum à metodologia é a adição de uma etapa final de extensão de PCR mais longa que permite a monoadenilação uniforme de todos os produtos (a DNA polimerase comumente usada nesta aplicação tem uma tendência de adicionar um único “A” às extremidades 3 'dos ​​amplicons) . Se não for permitido que isso vá para a conclusão, o produto final é uma mistura de produtos rombos e monoadensados, dando origem a duas bandas de produto separadas por um bp. A extensão final mais longa incentiva todos os produtos a serem monoadenilados e, assim, gerar um único pico uniforme - um pensamento agradável, mas que na realidade também é influenciado por sequências adjacentes, o que significa que os loci VNTR individuais tendem a ter "personalidades" distintas, conforme evidenciado por proporções características de esses dois picos, ou às vezes até mesmo uma série descendente de produtos “gaguejantes” - evidência de deslizamento de DNA no locus durante a PCR.

    De uma perspectiva de instrumentação, podemos usar eletroforese capilar (convenientemente disponível na forma de máquinas de sequenciamento Sanger antigas e confiáveis) para separar de forma confiável esses produtos por tamanho e cor, com precisão de dimensionamento auxiliada pela inclusão em um canal de corante dedicado de um padrão de tamanho em cada reação.

    Agora, se estendermos isso a uma série de locais e pudermos identificar o (s) produto (s) de cada um por alguma combinação de etiqueta de corante e / ou tamanho, podemos gerar um vasto número de combinações possíveis de tamanho de produto e padrões de cores - cada um reproduzivelmente gerado pelo DNA modelo de um indivíduo. Com o suficiente desses loci combinados, os resultados não são apenas reproduzíveis por indivíduo, mas também únicos (ou quase únicos, para alguma probabilidade astronomicamente alta) para aquele indivíduo. Com os loci comumente usados ​​para tipagem VNTR humana, apenas cerca de 12-15 marcadores são necessários para atingir níveis aceitáveis ​​de "singularidade".

    Interpretação

    Ocorrem pelo menos duas etapas de interpretação dos dados. A primeira é examinar diretamente os dados de eletroforese capilar em busca de marcadores esperados e “agrupar” os dados. Como agora entendemos, cada produto pode ocorrer em vários tamanhos predefinidos com base no comprimento do elemento de repetição, também percebemos que nem todos os loci se comportam bem e podem ter pico dividido (monoadenilação incompleta) ou problemas de intermitência. Embora isso possa parecer complexo, na realidade torna-se bastante simples interpretar os resultados e chamar cada locus como nulo (homozigoto excluído), heterozigoto com dois valores de tamanho ou homozigoto com um único valor de tamanho. (Alguns de vocês podem notar que há outra possibilidade, exclusão hemizigótica. Isso também será mostrado como um único pico para o tamanho do alelo presente e, embora a área do pico possa ser menor do que seria esperado para um homozigoto desse tamanho, geralmente podemos não detecte ou chame isso com certeza e poderia erroneamente chamar isso de homozigoto. Os locais são escolhidos de forma que as deleções sejam muito raras e, portanto, não se espera que essa condição seja observada.)

    Observe que, como estamos procurando picos em tamanhos conhecidos e esperados - e estes diferem em pelo menos dois e mais comumente três, quatro ou cinco nucleotídeos - pequenas variações na migração devido a, por exemplo, a diferença de força iônica entre as amostras não é significativa. Os tamanhos relatados pelo instrumento são "armazenados" no tamanho correspondente mais próximo de um produto aparente de 161,7 bp quando há alelos 161 e 166 conhecidos podem ser confortavelmente chamados de 161.

    Ao realizar essa pontuação / categorização em todos os conjuntos de marcadores, uma série ordenada de valores é gerada. Embora o número exato dependa do conjunto de marcadores escolhidos, como exemplo, uma iteração comercial comum deste método usa 15 loci VNTR clássico (produzindo 30 valores) e um loci adicional, que embora não seja estritamente um VNTR clássico pode ser tratado como um e produz mais dois valores (que indicam se o material de origem era masculino ou feminino) para um total de 32 valores. Este conjunto de valores é a "impressão digital" de amostra.

    Formulários

    Onde encontramos a tipagem VNTR usada em ambientes clínicos (não forenses) hoje? Eles podem ser aplicados a qualquer momento que desejamos vincular duas amostras, sendo duas das configurações mais comuns:

    • Teste de paternidade. Excluindo quaisquer mudanças de novo no número de cópias repetidas, uma criança deve herdar metade de seus marcadores VNTR de cada pai. O aparecimento de até mesmo um único locus na prole com um tamanho não representado nos pais putativos, significa que uma mudança de tamanho de novo ocorreu (possível, mas rara) ou muito mais provável, que um (ou ambos) os pais não t como pensamento. Dado o número total de loci examinados e a diversidade da população em cada locus, seria extremamente raro alguém não mostrar pelo menos alguma diversidade de um pai putativo não relacionado. Obviamente, nem é preciso dizer que tudo isso também pode ser aplicado pela mãe, no entanto, o teste de paternidade é mais comumente encontrado do que o teste de maternidade.
    • Rastreamento de amostra, particularmente em anatompatologia para blocos de tecido. Em alguns laboratórios, isso é empregado como um meio de garantir que as amostras de tecido FFPE possam ser rastreadas de forma inequívoca até o paciente de origem.

    Benefícios

    Finalmente, vamos nos perguntar por que essa tecnologia - desenvolvida cerca de 20 anos atrás, em um campo onde novas tecnologias surgem e frequentemente substituem métodos mais antigos - permanece relevante e em uso na linha de frente hoje. A resposta é que uma série de fatores contribuem para a robustez, precisão e confiabilidade inerentes do método a baixo custo e simplicidade. Alguns desses atributos incluem:

    • Baixa sensibilidade à contaminação. Como o método de leitura (eletroforese capilar) fornece tamanho de pico em pares de bases (o atributo medido) e uma altura de pico ou área de pico, geralmente é possível diferenciar claramente os sinais de um componente majoritário de traços de sinais de contaminantes. Com efeito, as reações de PCR nos loci alvo de um modelo estão competindo diretamente com os loci homólogos de um modelo contaminante. Como as eficiências de amplificação são essencialmente iguais, os tamanhos de pico relativos do (s) molde (s) contaminante (s) mais ou menos linearmente refletem as concentrações iniciais relativas. Em outras palavras, se um contaminante é 10 por cento da prevalência do modelo majoritário, seus picos de VNTR serão 10 por cento do tamanho dos picos majoritários. Isso permite uma avaliação rápida se uma amostra contém um único modelo ou vários modelos e, na maioria dos casos onde existe contaminação de baixo nível, para ler o sinal majoritário. No caso de uma amostra conter vários genomas em níveis quase iguais, embora a atribuição de marcadores para corrigir a fonte possa não ser possível, é pelo menos imediatamente aparente que vários genomas estão presentes (quando vários marcadores aparecem triplóides ou tetraploides, é uma amostra mista ) A probabilidade de uma mistura ou contaminação de amostra não detectada é muito baixa.
    • Sensibilidade muito alta. Como a PCR clássica é empregada para amplificar cada um dos loci marcadores, são possíveis sensibilidades até uma única cópia. Observe, no entanto, que conforme as demandas de sensibilidade aumentam, a resistência à confusão por contaminação diminui, pois as concentrações de contaminantes têm maior probabilidade de se aproximar daquelas do alvo desejado.
    • Bom desempenho em DNA de baixa qualidade. Como os amplicons individuais são bastante curtos (geralmente, 80-250 bp ou mais), o DNA que foi danificado e fragmentado ainda é bastante adequado para este método, quanto mais curtos forem os amplicons, menor será a probabilidade de uma quebra de DNA ou reticulação química ocorreu entre locais de primer em qualquer locus dado.
    • Utilitáriode resultados parciais. No caso de níveis de molde extremamente baixos e / ou danos de DNA muito graves, é possível que nem todos os loci possam fornecer resultados. Embora isso reduza o poder de identificação de um resultado, é por uma quantidade mensurável. A perda de apenas um ou dois marcadores de uma amostra - uma impressão digital parcial do DNA - ainda pode fornecer níveis informativos (até astronômicos) de certeza em um resultado de parentesco.
    • Os conjuntos de dados gerados são pequenos e facilmente manipulados. No exemplo dado acima, para um teste de 16 locus, um resultado completo é apenas uma sequência de 32 números uma pequena quantidade de dados por padrões computacionais, permitindo fácil armazenamento de imensos números de impressões digitais em um único banco de dados e pesquisa e comparação muito rápidas algoritmos. Em termos de manipulação de dados para medir o grau de parentesco entre as amostras, a matemática está bem estabelecida, requer pouca capacidade computacional, lida facilmente com grandes conjuntos de dados e pode ser visualizada de maneiras simples como árvores filogenéticas.
    • Baixo custo de infraestrutura e por ensaio. Os reais requisitos de instrumentação para este método são baixos, quase todos os laboratórios MDx têm o equipamento necessário em mãos. (Dependendo da aplicação particular do método, a maioria dos custos tem mais probabilidade de estar relacionados ao rastreamento da cadeia de custódia do que ao desempenho real do ensaio.)
    • Rapidez e facilidade de automação. A facilidade de automação é autoexplicativa em termos de velocidade de desempenho do ensaio, é um processo de extração de DNA, PCR, eletroforese capilar e interpretação. Em teoria, é possível realizar todas as etapas em um único dia de trabalho com poucas mãos no tempo.

    Essa não é nem mesmo uma lista exaustiva de todos os atributos de bom desempenho do método, mas já o suficiente para entender por que o método não foi suplantado e, francamente, não é provável que seja tão cedo. É uma maneira barata, confiável e comprovada de vincular amostras de DNA a indivíduos (ou entre si) e avaliar a inter-relação entre as amostras - útil em todas as formas mencionadas acima.


    Biologia molecular

    10-100 bp, mas a terminologia não é definida com precisão. Esses tipos de sequências também são chamados de regiões VNTR (número variável de repetição em tandem).

    10 & # 8211 4 por kb de DNA. (A frequência de trocas por locus real é considerada proporcional ao comprimento do minissatélite.) Esta taxa é

    10 e # 215 maior do que a taxa de recombinação homóloga na meiose, ou seja, em qualquer sequência aleatória de DNA.

    1000 minisatellites can be detected on Southern blot by a probe consisting of the core sequence.

    Both microsatellites and minisatellites are unstable, although for different reasons. Microsatellites undergo intrastrand mispairing, when slippage during replication leads to expansion of the repeat, as shown in Figure 4.28 (Jeffreys et al., 1988) Systems that repair damage to DNA, in particular those that recognize mismatched base pairs, are important in reversing such changes, as shown by a large increase in frequency when repair genes are inactivated (Strand et al., 1993) Because mutations in repair systems are an important contributory factor in the development of cancer, tumor cells often display variations in microsatellite sequences (see 30.29 Defects in repair systems cause mutations to accumulate in tumors).

    Ang paulit-ulit na DNA at Satellite DNA ay dalawang uri ng pag-uulit ng DNA na matatagpuan sa genome. Ang paulit-ulit na DNA ay mga paulit-ulit na paulit-ulit na pagkakasunud-sunod ng DNA habang ang Satellite DNA ay lubos na paulit-ulit, maikling pagkakasunud-sunod ng DNA. Ang pangunahing pagkakaiba sa pagitan ng paulit-ulit at satellite DNA ay ang antas ng pag-uulit.

    1.López-Flores, I., at MA Garrido-Ramos. "Ang Paulit-ulit na Nilalaman ng DNA ng Eukaryotic Genome." Karger Publisher, Hunyo 25, 2012, Magagamit dito.
    2.Garrido-Ramos, Manuel A. "Satellite DNA: Isang Nag-uusbong na Paksa." Mga Gen, MDPI, Setyembre 2017, Magagamit dito.


    Genome Analysis: Microsatellites or SNPs

    Mice and rats are a fundamental component of drug discovery research. Standard outbred stocks and inbred strains of rodents are used extensively for drug safety and pharmacokinetic testing. Our ability to generate specific mutants through transgene insertion or gene knockouts has greatly expanded their utility.

    The NIH has begun the Knock-Out Mouse Project (KOMP), an ambitious program to knock out every gene in the mouse genome. These knockouts are extraordinarily useful for modeling human diseases and elucidating key metabolic and regulatory pathways.

    These valuable animals have been widely disseminated throughout the research community. Unfortunately, there is a widespread perception that the phenotypes displayed by these animals are attributable to the genetic manipulations they carry. Isto não é necessariamente verdade. No gene acts alone, but in concert with all the other expressed genes in the organism. Even classic single-gene Mendelian traits, such as sickle cell anemia, display phenotypic variation due to the modifying effects of other genes. Thus the genetic background must be considered in these studies. Rapid, cost-effective, and comprehensive genotyping is essential.

    Mice and rats fall into two broad classes of genetic background. Inbred strains of animals have been generated by repeated sibling mating so that all the animals in an inbred strain are considered genetically identical. Outbred stocks of animals are managed to maximize genetic diversity between individuals. However, all outbred stocks start with a limited population and therefore are not nearly as heterogeneous as populations in the wild. Animals from an outbred stock will share common characteristics.

    The genetic background of animals used in research is of critical importance, as it can have profound effects on the observed phenotype. A phenotype can be profound in one strain and not affect another. In addition, there are cases in which the phenotype of interest was found to be an artifact of a contributing background strain.


    figura 1

    Genotyping Techniques

    Genetic background analysis is commonly done one of two ways. Microsatellite analysis begins with the identification of regions of non-coding DNA containing short repeats. Each repeat motif is commonly two, three, or four base pairs in size, and the number of repeats is highly variable between different strains. Figure 1 depicts several markers from Elchrom Scientific’s (www.elchcom.com) GenoMouse™ microsatellite panel. Single nucleotide polymorphisms (SNPs) are regions of the mouse genome in which two strains differ by a single base pair. Both methods of genome scanning have advantages and disadvantages depending on the application.

    Microsatellite polymorphisms can arise through replication slippage, unequal crossing over, or mutations extending or interrupting a series of repeats, whereas SNPs arise via point mutations.

    As a result, new microsatellite variations arise more frequently than new SNP variations. However, the absolute number of SNP differences between strains is about a thousand-fold higher than microsatellite differences. Thus, SNP and microsatellite analyses can provide complementary information, and each is better suited for some tasks than others.

    Formulários

    In humans, the HapMap project is attempting to delineate SNP differences between different populations with the goal of determining which SNPs are related to disease states. Because of the enormous number of SNPs in the genome, they are grouped into haplotypes. A haplotype is defined as a block of DNA that is inherited as a single unit, in which case one or a few SNPs can serve as markers for a large stretch of DNA. How applicable haplotype groups are throughout the human population is a matter of some debate.

    For forensic identification and paternity testing, microsatellites are used. This enables many fewer loci to be examined, as each locus can exhibit a variety of repeat lengths. The FBI CODIS system requires just 13 microsatellite markers for a standard analysis.

    Options for genome scanning include in-house screening, or core or commercial services such as Elchrom Scientific’s GenoMouse.


    Figura 2

    Controle de qualidade

    Misbreedings and animal mix-ups will inevitably occur, even in the best-run animal facilities. Figure 2 illustrates such a situation. Undetected, such mistakes can sabotage experiments, wasting huge amounts of money and time. Good husbandry demands routine genetic monitoring of breeding stocks. Microsatellite analysis is advantageous here, because if a contamination is detected, the sizes of the aberrant microsatellite loci can often provide information on the contaminating strain.

    Speed Congenics

    Because the background strain can play a major role in phenotype, it is important to examine test animals on a uniform genetic background, and ideally on several genetic backgrounds. Backcrossing, the breeding process used to transfer a gene or allele of interest from one strain to another, is a slow and laborious process, taking approximately three years. By analyzing the genomes of backcrossed offspring and selecting the animals with the highest percentage of the desired background strain, it is possible to cut the time required in half.

    Mathematical modeling shows that markers spaced approximately 15 cM apart are effective, and finer mapping does not provide significantly greater speed. GenoMouse uses 96 markers, six on chromosome 1, the largest chromosome, and five markers on all the other autosomes. The sex chromosomes can usually be fixed by breeding rather than selection. The huge datasets generated by SNP analysis are unwieldy for this application.

    Gene Maping and Quantitative Locus Analysis

    Quantitative traits are those traits that show a continuous variation over a range of phenotypes. The phenotype is composed of the combined effects of multiple genes, some with large effects, some with small. To identify the contributing genes, animals from a genetically heterogeneous population are selected for extremes of the trait of interest. They would then be analyzed by genome scanning in order to identify a locus that segregates with the trait.

    Frequently a known candidate gene is present in this region, but sometimes not. The spacing of mouse microsatellite markers, at about one every 100 kb, can be sufficient to identify the gene. SNP markers occur approximately once every kb. It is straightforward to begin a gene hunt with microsatellite markers and then switch to SNPs once the region has been sufficiently defined.

    Comparações

    One significant advantage of microsatellite analysis is its robustness. The difficult part of the assay is identifying primer sets that amplify well, are well-spaced across all the chromosomes, and show polymorphisms with a size difference sufficient for accurate resolution with the chosen analysis technique. Primer panels may be purchased commercially or developed in-house (a significant research and development undertaking).

    Once the primer sets are in hand, microsatellite analysis can be reassuringly straightforward. Markers are amplified via standard PCR methods and usually sized on gels. Agarose gels are common, although sometimes polyacrylamide gels are chosen for their finer resolution. Elchrom Scientific has a series of hydrogels, which offer clear bands and discrimination of bands with as small a distance as a single base pair. These provide agarose gel electrophoresis with precision equal to to that of polyacrylamide gels.

    Data interpretation of microsatellite assays is straightforward and based on visual identification of the polymorphisms. Unlike microarray data, statistical analysis is not required, and the assay is highly reproducible between different researchers and laboratories.

    The mouse genome differs significantly from the human genome. Some applications that are SNP-based for the human genome may be better approached in the mouse by microsatellite analysis, as mice have two to three times as many microsatellite loci as humans. Mice also have much longer SNP deserts. Thus mouse researchers should evaluate their needs carefully and not rely on human precedent in choosing whether to genotype with SNPs or microsatellites.


    Application of Microsatellite Markers in Conservation Genetics and Fisheries Management: Recent Advances in Population Structure Analysis and Conservation Strategies

    Microsatellites are the most popular and versatile genetic marker with myriads of applications in population genetics, conservation biology, and evolutionary biology. These are the arrays of DNA sequences, consisting of tandemly repeating mono-, di-, tri-, and tetranucleotide units, which are distributed throughout the genomes of most eukaryotic species. Microsatellites are codominant in nature, highly polymorphic, easily typed, and Mendelian inherited, all properties which make them very suitable for the study of population structure and pedigree analysis and capable of detecting differences among closely related species. PCR for microsatellites can be automated for identifying simple sequence repeat polymorphism. Small amount of blood samples or alcohol preserved tissue is adequate for analyzing them. Most of the microsatellites are noncoding, and therefore variations are independent of natural selection. These properties make microsatellites ideal genetic markers for conservation genetics and fisheries management. This review addresses the applications of microsatellite markers in conservation genetics and recent advances in population structure analysis in the context of fisheries management.

    1. Introdução

    Organisms are incessantly undergoing micro- and macroevolutionary processes both at molecular and organismal levels. In fact, the process of evolution starts at the molecular level, more precisely from a single base of the DNA molecule, and ends up in variations at the organismal level. Genes are the factors, which determine the phenotypic characters of any organism. Thus, the variations that happen to the genes in turn produce individuals, which are different either at the molecular level or at the organismal level. These individuals may form separate groups within the species itself and such groups are the fundamental genetic units of evolution. These intraspecific groups were called as “stocks” and fishery biologists started using these stocks as a basis to manage commercially important marine organisms. Shaklee et al. [1] defined a stock as “a panmictic population of related individuals within a single species that is genetically distinct from other such populations.” Therefore, in any management regime, identification of discrete stocks becomes a critical element [2, 3].

    Genetic variation in populations became a subject of scientific enquiry in the late nineteenth century prior even to the rediscovery of Mendel’s paper in 1900. Genetic variation, in the form of multiple alleles of many genes, exists in most natural populations. In most sexually reproducing populations, no two organisms (barring identical twins or other multiple identical births) can be expected to have the same genotype for all genes [4]. In 1990s, genetic markers became more popularized for the identification of stock structure and genetic variation in a population. The detection of genetic variation among individuals is a requirement in all applications of genetic markers in fisheries biology. A genetically inherited variant in which the genotype can be inferred from the phenotype during genetic screening is known as a genetic marker. The most common use of genetic markers in fisheries biology is to determine if samples from culture facilities or natural populations are genetically differentiated from each other. They are also used to identify different species in the event of taxonomic disputes and to detect genetic introgression in a species. The detection of genetic differentiation would imply that the source groups comprise different stocks [5] and should be treated as separate management units or stocks [6]. A common objective of molecular genetic analyses is to find diagnostic differences among presumed stocks in either nuclear allelic types or mtDNA haplotypes [7]. Polymorphic DNA markers can provide fisheries researchers with new insights into the behavior, ecology and genetic structure of fish populations, levels of inbreeding, disassortative mating success of alternative reproductive strategies and life histories, and the intensity of natural and sexual selection [8]. Microsatellites are one of the best suitable genetic markers for analyzing pedigree, population structure, genome variation, evolutionary process, and fingerprinting purposes.

    Genetic markers are basically two types—protein and DNA (molecular). In the beginning of 1960s, the proteins such as haemoglobin and transferrin were involved in all studies. In protein markers, allozyme markers are very popular and most of the genetic variation studies have been conducted based on this marker [9–14]. Molecular markers can be categorized into two classes, nuclear DNA and mitochondrial DNA (mtDNA) markers, based on their transmission and evolutionary dynamics [15]. Nuclear DNA markers such as random amplified polymorphic DNA (RAPDs), amplified fragment length polymorphisms (AFLPs), variable number of tandem repeats loci (VNTRs: minisatellites, microsatellites), and single nucleotide polymorphisms (SNPs) are biparently inherited. Mitochondrial DNA markers are maternally inherited, exhibit high rates of mutation, and are nonrecombining such that they have one-quarter the genetic effective population size (Ne) of nuclear markers [8]. Using restriction enzymes mtDNA sequence can be cut at specific sites to generate restriction fragment length polymorphisms (RFLPs) or sequence analysis of different genes of mtDNA can be used to detect phylogenetic relationships, undertake pedigree analysis, and assess population differentiation in many species.

    Detection of polymorphisms at the nucleotide sequence level represents a new area for genetic studies, especially as technologies become available, which allow routine application with relative ease and low cost. From the 1990s an increasing number of studies have been published making use of random parts of a genome. With the advent of thermocyclers, the amplification of small fragment of DNA through polymerase chain reaction (PCR) gained popularity. The PCR technique was discovered in 1985 and the development of DNA amplification using the PCR technique has opened the possibility of examining genetic changes in fish populations over the past 100 years or more using archive materials such as scales [8]. The advent of PCR coupled with automated DNA sequencers made feasible major technological innovations such as minisatellite variant repeat mapping [16] and assessment of the variations at microsatellite loci [17]. The PCR based techniques have the added attraction of requiring only extremely small amounts of DNA that has led to wide usage of this technique in aquaculture and fisheries. In this review, we discuss the application of the most prevalent genetic marker, microsatellites, in population genetic structure and its usefulness in conservation of fish fauna.

    2. Microsatellites Markers

    Recently, attention has turned to another type of genetic variation that of differences in the number of repeated copies of a segment of DNA. These sequences can be classified based on decreasing sizes into satellites, minisatellites, and microsatellites [13]. Satellites consist of units of several thousand base pairs, repeated thousands or millions of times. Minisatellites consist of DNA sequences of some 9–100 bp in length that are repeated from 2 to several 100 times at a locus. Minisatellites discovered in human insulin gene loci with repeat unit lengths between 10 and 64 bp were also referred to as “variable number of tandem repeats” (VNTRs) DNA [18]. Microsatellites have a unique length of 1–6 bp repeated up to about 100 times at each locus [19]. They are also called as “simple sequence repeat” (SSR) by Tautz [13] or “short tandem repeat” (STR) DNA by Edwards et al. [20]. Jeffreys et al. [21] and Weber [22] opined that length variations in tandemly arrayed repetitive DNA in mini- and microsatellites are usually due to an increase or decrease in repeat unit copy numbers. Differences in repeat numbers represent the base for most DNA profiling techniques used today. Later, only microsatellites became very common in population genetics studies.

    Microsatellites are short tandemly arrayed di-, tri-, or tetranucleotide repeat sequences with repeat size of 1–6 bp repeated several times flanked by regions of nonrepetitive unique DNA sequences [13]. Polymorphism at microsatellite loci was first demonstrated by Tautz [13] and Weber and May [17]. Alleles at microsatellite loci can be amplified by the polymerase chain reaction [23] from small samples of genomic DNA and the alleles separated and accurately sized on a polyacrylamide gel as one or two bands and they are used for quantifying genetic variations within and between populations of species [24]. The very high levels of variability associated with microsatellites, the speed of processing, and the potential to isolate large number of loci provide a marker system capable of detecting differences among closely related populations. Microsatellites that have been largely utilized for population studies are single locus ones in which both the alleles in a heterozygote show codominant expression [25]. Individual alleles at a locus differ in the number of tandem repeats and as such can be accurately differentiated on the basis of electrophoresis (usually PAGE) according to their size. Different alleles at a locus are characterized by different number of repeat units. They give the same kind of information as allozymes: distinguishable loci with codominant alleles, but they are generally neutral and more variable than allozymes [26]. Like allozymes, microsatellites alleles are inherited in a Mendelian fashion [27]. Moreover, the alleles can be scored consistently and compared unambiguously, even across different gels. An additional advantage is that they allow the use of minute or degraded DNA [26].

    Generally, microsatellite loci are abundant and distributed throughout the eukaryotic genome [28] and each locus is characterized by known DNA sequence. These sequences consist of both unique DNA (which defines the locus) and repetitive DNA motifs (which may be shared among loci). The repetitive elements consist of tandem reiterations of simple sequence repeats (SSRs) and are typically composed of two to four nucleotides such as (AC)n or (GATA)n Onde n lies between 5 and 50 [29]. Within vertebrates, the dinucleotide repeats -GT and CA- are believed to be the most common microsatellites [30]. Study of single locus microsatellites requires specific primers flanking the repeat units, whose sequences can be derived from (i) genomic DNA libraries or (ii) from available sequences in the gene banks (Figures 1 and 2). These two methods are generally used for the development of microsatellite markers. The second method is extensively described in the coming section. In a review, Zane et al. [31] showed several methods of development of microsatellite markers.


    SSRs in Coding Regions

    Nonrandom Distribution

    Numerous SSRs exist in ORFs of higher eukaryotes including Drosófila, Caenorhabditis elegans, mammals, humans, plants, and yeast ( Tóth, Gáspári, and Jurka 2000 Katti, Ranjekar, and Gupta 2001 Kantety et al. 2002 Morgante, Hanafey, and Powell 2002). SSR occurrence in coding regions seems to be limited by non-perturbation of the reading frame. This has been proved by the following facts: (1) in a human cDNA database, more than 92% of the predicted SSR polymorphisms within coding sequences have repeat-unit sizes that are a multiple of three ( Wren et al. 2000) (2) in many species, exons (unlike other genomic regions) contain rare dinucleotide and tetranucleotide SSRs, but have many more triplet and hexanucleotide SSRs than other repeats ( Field and Wills 1996 Edwards et al. 1998 Metzgar, Bytof, and Wills 2000 Wren et al. 2000 Young, Sloan, and van Riper 2000 Cordeiro et al. 2001 Morgante, Hanafey, and Powell 2002). Triplet repeats show approximately twofold greater frequency in exonic regions than in intronic and intergenic regions in all human chromosomes except the Y chromosome ( Subramanian, Mishra, and Singh 2003). In prokaryotic genes related to adaptation or responses to stress of Escherichia coli K12, mononucleotide and trinucleotide SSRs are significantly overrepresented, whereas dinucleotide and tetranucleotide repeats are underrepresented ( Rocha, Matic, and Taddei 2002). Such dominance of triplets over other repeats in coding regions may be explained on the basis of the suppression of non-trimeric SSRs in coding regions, possibly caused by frameshift mutations ( Metzgar, Bytof, and Wills 2000).

    The presence of SSRs in coding regions shows bias to some specific nucleotide composition. Thus, A/T repeats are more frequent (11.8% of 45,425 coding sequences: CDSs) than G/C repeats (0.7%) in human coding sequences ( Olivero et al. 2003). Exons and ESTs show higher frequency for GA/CT repeat than for AT repeat in Arabidopsis thaliana ( Morgante, Hanafey, and Powell 2002) and cereals ( Kantety et al. 2002 Morgante, Hanafey, and Powell 2002). The AC/GT repeats in plants were more rare than in animal genomes ( Tóth, Gáspári, and Jurka 2000 Morgante, Hanafey, and Powell 2002). This pattern may be related to high frequencies of certain amino acids in plants than in animals ( Tóth, Gáspári, and Jurka 2000).

    Triplet repeats in exons can be grouped into 10 motif subclasses ( table 1), each representing six overlapping and complementary unit patterns ( Jurka and Pethiyagoda 1995). In the animal kingdom, AGC was the most common motif (40.9%–60.9%). In plants, the most frequent triplet motif is AAG subclass (28.3%–42.1%) in A. thaliana, grape, and endophytes ( table 1). In cereal species, however, the most common triplet is CCG in all the species, ranging from 32% in wheat to 49% in sorghum ( Varshney et al. 2002 Thiel et al. 2003), to 39.3% in sugarcane ( Cordeiro et al. 2001). The abundance of CCG repeats is a specific feature of monocot genomes, and it may be due to their increased GC content ( Morgante, Hanafey, and Powell 2002). The AAT motifs were the least common (<1%) in monocot species ( Cordeiro et al. 2001 Varshney et al. 2002 Thiel et al. 2003) and in other species listed in table 1. This may be explained by the fact that TAA-based variants code for stop codons that have a direct effect on protein synthesis in eukaryotes.

    Frequencies of Different Codon Repeats Vary Considerably Depending on the Type of Encoded Amino Acid

    In plants, the most common codon repeats are codons for Lys in Arabidopsis and codons for Arg in sugarcane ( table 2). No Drosófila, C. elegans, and yeast, the most common codon repeats are CAA and CAG encoding Gln in complete genome coding DNA sequences ( Katti, Ranjekar, and Gupta 2001). It is interesting that those expansions of codon repeat corresponding to small/hydrophilic amino acids are more tolerated (with ≥14 repeat times) than are hydrophobic amino acids (with shorter repeat times) ( Katti, Ranjekar, and Gupta 2001). At the DNA level, the AGC, GCA, CAG, CTG, TGC, and GCT repeats (representing the same repeating DNA duplex) are quite similar, and their frequencies can be expected to be comparable. In fact, however, Drosófila coding regions display a strong bias to CAG (Gln: 77.5% of a total of 1,909 of this repeat group), and very rare for CTG (leucine: 0.6%) and TGC (cysteine: 0.2%) ( Katti, Ranjekar, and Gupta 2001). In yeast proteins, the most abundant amino acid repeats are codons of Gln, Asn, Asp, Glu, and Ser ( Richard and Dujon 1997 Alba, Santibáñez-Koref, and Hancock 1999). Different amino acid repeats are concentrated in different classes of proteins. Acidic and polar amino acid repeats are significantly associated with transcription factors and protein kinases, whereas Ser repeats are significantly associated with membrane transporter proteins ( Alba, Santibáñez-Koref, and Hancock 1999). Interestingly, in yeast, the longest triplet repeats (≥ 75 bp) are often found in nuclear-protein genes ( Richard and Dujon, 1997). Strong bias in favor of certain limited sets of amino acids in different proteins or cell locations showed that triplet repeats in ORFs were nonrandom with respect to the ORFs and DNA strands ( Richard and Dujon 1997). Similarly, in humans and mice, repeat-containing genes were enriched in certain amino acids such as Pro, Gln, His, and Ser (for codons, see table 2 Hancock, Worthey, and Santibáñez-Koref 2001). Likewise, CGG, CCG, CAG, and GAA repeats coding for (Ala)n, (Gly)n, (Pro)n, (Gln)n, and (Lys)n are abundant in primate genes ( Borštnik and Pumpernik 2002). The above evidence may suggest that functional selection acts on amino acid reiteration in the encoded proteins ( Alba, Santibáñez-Koref, and Hancock 1999 Katti, Ranjekar, and Gupta 2001), but this selection did not reflect underlying biases in base composition.

    The abundance of CAG repeats in yeast coding regions ( Alba, Santibáñez-Koref, and Hancock 1999 Katti, Ranjekar, and Gupta 2001) parallels its abundance in mammalian exons ( Stallings 1994). However, AAT repeats, also very abundant in yeast coding regions, are rare in the exons of mammals, and GGC repeats, relatively abundant in mammalian exons ( Stallings 1994), are uncommon in yeast genes. This may be because Asn repeats (AAT) are not tolerated in mammals, and that the same is true for Gly repeats (GGC) in yeast. Asn repeats appear to be rare in vertebrates but more common in invertebrate, yeast, and plant proteins ( Stallings 1994). Alternatively, these differences could be due to differences in the slippage process between the groups, or they may reflect the low GC content of the yeast genome ( Richard and Dujon 1997).

    Phenotypic Effect of SSRs in Coding Regions

    Simple sequence repeat variation within genes should be very critical for normal gene activity because encoding SSR expansion or contraction directly affects the corresponding gene products and even causes phenotypic changes. In eukaryotes, SSR effects in coding regions on phenotypes have been extensively studied only in human diseases, revealing abundant evidence on human neuronal disorders and cancers.

    Exon CAG Repeat Expansion Produces Toxic Mutant Proteins Causing Human Diseases

    Human repeat expansion diseases are predominantly neurological and are caused by instability and expansion of triplet motifs within or near genes (reviewed in Cummings and Zoghbi 2000 Masino and Pastore 2002). The largest class of these diseases results from the expansion of coding CAG repeats that are translated into extended (Gln)n tracts within the corresponding proteins. These dominantly inherited diseases include Huntington's disease (HD), dentatorubro-pallidoluysian atrophy (DRPLA), spinobulbar muscular atrophy (SBMA), and spinocerebellar ataxia (SCA1, SCA2, SCA3, SCA6, and SCA7 table 3). All eight disorders are progressive, typically striking in midlife, and causing increased neuronal dysfunction and eventually neuronal loss 10–20 years after the onset of symptoms. Several other features characterize this group of diseases: the greater the number of CAG repeats on expanded alleles, the earlier the age of onset and the more severe the disease. The repeats show both somatic and germline instability (see review: Zoghbi and Orr 2000 Lima et al. 2001). Successive generations of affected families experience anticipation, or earlier age of onset, and more rapid disease progression as a result of intergenerational repeat instability that is particularly marked in paternal transmissions. CAG contraction within androgen receptor gene was involved in cancer or other diseases ( table 3).

    How could the expanded CAG repeats cause these diseases? There is strong evidence demonstrating that the expanded (Gln)n stretch confers either a gain- or change-of-function onto the corresponding proteins (see reviews: Galvão et al. 2001 Ranum and Day 2002). In most cases, a toxic gain of function of the mutant protein was demonstrated. For instance, both cell culture and animal studies clearly demonstrate that a long (Gln)n tract is toxic to neurons and peripheral cells alike ( Galvão et al. 2001). Additional peptide sequences from expanded CAG repeats must contribute to the late onset of these diseases and selective neuronal vulnerability. This neuronal selectivity disappears in the earliest juvenile-onset cases, when the (Gln)n tract becomes disproportionately large relative to the rest of the protein there may be a threshold for Gln repeat length beyond which it becomes the predominant toxic moiety ( Zoghbi and Orr 2000). It is also possible that RNAs containing CAG expanded repeats may either interfere with processing of the primary transcript, resulting in a deficit of the corresponding protein, or interact with RNA-binding proteins, altering their normal activity (see review: Galvão et al. 2001). Recent experiments suggest that, in addition to the ubiquitin/proteasome pathway, mutant proteins with expanded (Gln)n stretches are involved in the lysosomal pathway for protein degradation, and that this processing mechanism may serve as a target for new therapeutic approaches to CAG repeat diseases ( Yamada, Tsuji, and Takahashi 2002).

    Monomer SSR Variation in Coding Regions Inactivates MMR Genes via Frameshift, but Leads Also to Other Truncated Proteins in Tumor Cells

    Microsatellite instability (MSI) occurs in about 90% of hereditary nonpolyposis colorectal cancers (HNPCC) as well as in about 15% of sporadic tumors of the colon ( Mark Redston 2001), in numbers of gastric ( Yamada et al. 2002uma), lung ( Zienoddiny et al. 1999), and endometrial cancers ( Vassileva et al. 2002). It has been proved that many MSI tumors are caused by mutational inactivation of the different MMR genes listed in table 3. The mutational inactivation was caused mainly by a frameshift occurring within the (A)n tracts located in exons of both major and minor MMR genes (for review, see Duval and Hamelin 2002), except the methylation of the hMLH1 promoter ( Yanagisawa et al. 2000).

    Likewise, a number of SSR-containing genes (listed in table 3) are frequently affected by the MSI in tumor cells. Like the MMR genes, these genes also contain (A)n tracts in coding regions, which can lead to frameshift mutation in MMR-defective cells ( Duval and Hamelin 2002). The proteins encoded by these genes display tumor-suppressive functions and, thus, represent major targets of mutator pathway-associated carcinogenesis ( Schwartz et al. 1999). Most MSI–High-frequency (MSI-H) tumors had acquired frameshift mutations in more than one gene among hMSH3, hMSH6, BAX, IGFIIR, TGFbetaIIR, E2F4, and BRCA2 ( Johannsdottir et al. 2000).

    The human hTCF4 gene interacts functionally with β-catenin in the Wnt signaling pathway. Alternative use of different reading frames in the exon 17 of hTCF-4 generates different protein isoforms with agonist or antagonist transactivating activities ( Duval et al. 2000). A 1-bp deletion in an (A)9 repeat within exon 17, as well as other frameshift mutations, results in decreasing the proportion of the long COOH-terminal hTCF-4 isoform, which contains two binding domains for c-terminal binding protein, a protein implicated in the repression of the TCF family transcriptional activity. Thus, loss of the TCF-4 capacity to interact with COOH-terminal binding protein could have an important effect in colorectal carcinogenesis by modifying Wnt-signaling ( Duval et al. 2000).

    SSR Variation in Coding Regions Affects Gene Expression and Pathogenesis in Prokaryotes

    The presence of SSRs in prokaryotes is rare, but most that do occur are related to pathogenic organisms their variation in repeat numbers can also cause phenotypic changes (reviewed in van Belkum et al. 1998). These SSR motifs were reminiscent of the presence of repetitive elements consisting of uptake signal sequences, intergenic dyad sequences, and multiple tetranucleotide iteration ( Karlin, Mrazek, and Campbell 1997). Haemophilus influenzae (Hi), an obligate upper respiratory tract commensal/pathogen, uses phase variation (PV) to adapt to host environment changes. Switching occurs by slippage of SSR repeats within genes coding for virulence molecules ( Hood et al. 1996). Most such SSRs in Hi are tetranucleotide repeats, which are listed in table 3. The high prevalence of tetranucleotides mediating PV is an exceptional feature of the Hi genoma. For instance, Weiser, Love, and Moxon (1989) found that different patterns of lipopolysaccharide expression (LPS: LPS phase variation functions as an adaptation mechanism enabling bacteria to escape the immune system attack and to translocate across various physical barriers: van Putten 1993) and the molecular switch leading to this phenotypic variability appeared to be dependent on the translational capacity of the gene lic1 mRNA, which is caused by variable numbers of a CAAT motif within this gene. Variation in the overall number of this CAAT unit moves one of the three ATG codons in or out of the protein synthesis reading frame, and it then directly affects protein synthesis and the primary amino acid sequence. More examples are listed in table 3.

    Variation in the opacity surface proteins (Opa) occurs by recA-independent rearrangements in the coding repeat sequence. In this region, shifting of the translational reading frame occurs because of changes in the repetitive DNA track ( Murphy et al. 1989). These changes occur independently in any of the opa genes, which account for the production of several different Opa proteins simultaneously. The relationship between the superficial Opa protein composition of a bacterial isolate with invasiveness into the human epithelium has been demonstrated experimentally ( Makino, van Putten, and Meyer 1991). A variable number of CTCTT motifs in the opa leader peptide moves the reading of the gene in or out of the frame. This sequence is peculiar because a triple-helix conformation is likely to occur, and the CTCTT repeat region appears to be hypersensitive to single-strand-specific nuclease. The number of repeats varies continuously at low frequency in vivo. Once environmental selection influences survival of one of the “minority SSR types,” this type will “translate” its selective advantage into overgrowth of the existing population ( Makino, van Putten, and Meyer 1991).

    In general, the examples mentioned in this section and in table 3 emphasize the importance of SSR elements in many aspects of adaptativo behavior in bacteria. SSR variations enable bacteria to respond to diverse environmental factors, and many of them are clearly related to bacterial pathogenesis and virulence. The contingent genes containing SSRs show high mutation rates, allowing the bacteria to act swiftly on deleterious environmental conditions ( Moxon et al. 1994). Some of the SSRs seem to play an essential role in controlling surface exposition of active protein domains and antigenic variation.


    What are microsatellite markers?

    Clique para ler a resposta detalhada. In this way, what are microsatellite markers used for?

    Microssatélites are widely usado para DNA profiling, also known as "genetic fingerprinting", of crime stains (in forensics) and of tissues (in transplant patients). They are also widely usado em kinship analysis (most commonly in paternity testing).

    Secondly, what are Minisatellites and microsatellites? UMA minisatellite is a tract of repetitive DNA in which certain DNA motifs (ranging in length from 10&ndash60 base pairs) are typically repeated 5-50 times. Confusingly, minisatellites are often referred to as VNTRs, and microssatélites are often referred to as short tandem repeats (STRs) or simple sequence repeats (SSRs).

    In this manner, what are two features of microsatellites?

    Particular characteristics of microsatellites, such as their presence in the genomes of all living organisms, high level of allelic variation, co-dominant mode of inheritance and potential for automated analysis make them an excellent tool for a number of approaches like genotyping, mapping and positional cloning of

    Why microsatellites are still a marker of choice in population genetic studies?

    Microsatellite markers are useful for population genetic studies because many are considered highly polymorphic. These different allele frequencies increase the potential to observe genético diferenças entre populações if they exist.


    Assista o vídeo: #017: Bezpieczeństwo satelitów w kosmosie (Agosto 2022).